exception alignment error Dice Kentucky

Address 117 Mountain Ave, Hazard, KY 41701
Phone (606) 439-4999
Website Link
Hours

exception alignment error Dice, Kentucky

try to use NODELETS instead of NODES. Exported without a hitch. Syntactically, __unaligned is a type qualifier like const and volatile; it controls the meaning of what the pointer points to. __unaligned has meaning only when used in a pointer declaration. You could split the reads with splice junctionsc (N in CIGAR) using either Gatk 3.0 or, if you're adventurous, try my python alternative: https://github.com/mjafin/splitNreads — Reply to this email directly or

Owner ekg commented Feb 2, 2016 I think the problem you are encountering is fixed in a very recent version. Blog Archive ► 2014 (55) ► September (2) ► August (3) ► July (6) ► June (4) ► May (2) ► April (6) ► March (3) ► February (10) ► January Join them; it only takes a minute: Sign up MIPS “Unaligned address, Exception 5” error up vote 0 down vote favorite I'm a noob using SPIM MIPS simulator. In the output, function f_improper shows the code generated by the improper handling of unaligned data, and function g_proper shows the extra code generated when __unaligned is used.

Thank you for any help that you can provide! It is not much of an insight, I recognise. … On Jun 1, 2015, at 15:58, Travis Collier ***@***.***> wrote: @inti ... A spurious interrupt occurs when an unnecessary interrupt is raised for an already processed packet, possibly due to an internal race condition, or improper initialization of interrupt handling routines. I attached a screenshot of the area causing the error in igv viewer.

The introns are pretty obvious. The tracebacks for alignment errors can generally be decoded to reveal the function causing the alignment problems. Erik … On Wed, Jun 11, 2014 at 1:47 PM, Miika Ahdesmaki ***@***.***> wrote: @freemao FreeBayes doesn't dig splice junctions. Privacy policy About Wikipedia Disclaimers Contact Wikipedia Developers Cookie statement Mobile view current community chat Stack Overflow Meta Stack Overflow your communities Sign up or log in to customize your list.

The show align command provides information on spurious memory accesses, but not spurious interrupts. Thank you for any help that you can provide! GGGGAACTAGATGTTTTTCAACCATGAACTTCTCGTAATTATGGGTGATGGAACTTTATATATTCATTAGAAGTCCAAAAAAAAATCCGTATACTCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG ATGGATTCCCTCTTTCTGTTTATGTTTTGTTAGAGATGGATGACGTACATAATCTGCTTGTCTTGTTTCAGGGAATCTGTACATATGCACAGTATACTTGAAAACAAGAGACGAAGCGGTGGAAGGATAATAGAGAAGACCGCCATGTTGGTGTAGCATCGATCGATGTTGTCA Chr1:10333 Aborted (core dumped) The other error info (This bam file also from tophat which options were same as the above): terminate called after throwing an instance of 'std::out_of_range' Generated Sat, 15 Oct 2016 10:39:01 GMT by s_ac15 (squid/3.5.20)

The first error just same as above.I also used the bam files generated from tophat. I have no idea, haven't used any older version. Avoiding Alignment Errors (Windows CE 5.0) Windows CE 5.0 Send Feedback All data types are either primitive types, or complex types that consist of arrays, structures, or unions of simpler types. holtgrewe commented Mar 16, 2015 👍 I'm getting this problem as well.

On POSIX-compliant platforms, bus errors usually result in the SIGBUS signal being sent to the process that caused the error. This is inter-structure alignment. inti commented Jun 1, 2015 Yes, a suitable change on the freebayes code would be way better. for example for variants calling and haplotyping exonic variants with RNA-seq? @mjafin @visze have you solve this?

Wikipedia® is a registered trademark of the Wikimedia Foundation, Inc., a non-profit organization. strb r3, [r0, #1] strb r3, [r0, #2] strb r3, [r0, #3] mov pc, lr Because there is a performance penalty for accessing data through an unaligned pointer, use the __unaligned To add: Getting same issue on MediaComposer 6.0.1, Symphony 6.0.1 and Symphony 6.0.1.1.. [view my complete system specs] Tue, Sep 25 2012 9:46 AM In reply to MrSanMan Joined Components Used The command is not supported on all platforms (only in reduced instruction set computing [RISC] processors).

I have been planning a better workaround. agata-sm commented Feb 2, 2016 Thanks! We have looked at data alignment, but stacks and data structures are also aligned, as well as, instructions. Thursday, 12 December 2013 Understanding Data Alignment and Alignment Exceptions The following topic, is much more related to CPUs rather than the operating system.

Copy #pragma pack (1) struct s { char c; // offset 0 int i; // offset 1! } ss; #pragma pack () void f_improper(int *p) { *p = 23; // generates The difficulty I see is dealing with when freebayes combines "CIGAR N to D recoded" introns into adjacent variations. Sorry for the trouble but this is the easiest way to resolve things! … On Mar 27, 2015 1:45 PM, "Max" ***@***.***> wrote: +1 — Reply to this email directly or If there are continuous alignment errors, the router can spend most of its time fixing them, increasing the CPU utilization.

The file already has read groups added. I attached a screenshot of the area causing the error in igv viewer. We appreciate your feedback. Program received signal SIGBUS, Bus error. 0xb6ee27fa in ros::SubscriptionCallbackHelperT > const> const&, void>::deserialize(ros::SubscriptionCallbackHelperDeserializeParams const&) () from /home/name/ros/navigation/costmap_2d/lib/libcostmap_2d.so (gdb) bt #0 0xb6ee27fa in ros::SubscriptionCallbackHelperT > const> const&, void>::deserialize(ros::SubscriptionCallbackHelperDeserializeParams const&) () from /home/name/ros/navigation/costmap_2d/lib/libcostmap_2d.so

In such cases, you can still use packed structures if you also carefully unpack members of a packed structure before using data in the program. References[edit] ^ z/Architecture Principles of Operation, SA22-7832-04, Page 6-6, Fifth Edition (September, 2005) IBM Corporation, Poukeepsie, NY, Retrievable from http://publibfp.dhe.ibm.com/epubs/pdf/a2278324.pdf (Retrieved December 31, 2015) ^ https://groups.google.com/group/comp.unix.internals/browse_thread/thread/6369e8f923aedcb0/54f8ed15e326dc0[unreliable source?] v t e Operating If the AC (Alignment Check) flag is set to 0, then the above is true like the x86, otherwise if set to 1, an exception is thrown that the CPU is Introns would then come out as deletions where the CIGAR is all Ns (or N#).

Determine if a coin system is Canonical Make space between rows constant Are independent variables really independent? mov pc, lr g_proper:: mov r3, #0x2A strb r3, [r0] // Four individual bytes are stored, mov r3, #0 // avoiding an alignment fault. agata-sm commented Feb 2, 2016 Hi, I am aware that this is a couple of months old thread, have you found any solution? mjafin commented Mar 27, 2015 @ekg I sent you an example file about a year ago (see above).

Already have an account? Add Answer Question Tools Follow 2 followers subscribe to rss feed Stats Asked: 2013-01-15 05:50:02 -0500 Seen: 1,396 times Last updated: Mar 05 '13 Related questions predefined compiler macro __arm not Browse other questions tagged assembly mips spim or ask your own question. When opening a case to report spurious accesses, please include the following: output from the show alignment command output from the show tech-support command relevant system logs Alignment Errors The following

Dev centers Windows Office Visual Studio Microsoft Azure More... Unsourced material may be challenged and removed. (July 2015) (Learn how and when to remove this template message) In computing, a bus error is a fault raised by hardware, notifying an A couple of spurious interrupts do not cause much CPU utilization. This keyword cannot resolve alignment problems of pre-existing classes such as in inherited code, or in the Microsoft Foundation Class Library.

Proudly Powered by phpBB © phpBB Group © 1998-2015 mozillaZine All Rights Reserved Developer Network Developer Network Developer Sign in MSDN subscriptions Get tools Downloads Visual Studio MSDN subscription access SDKs Please sign in help tags users badges ALL UNANSWERED Ask Your Question 2 Arm Architecture with armhf port, Move_base Bus Error Alignment trap/exception edit move_base map_server fault exception trap bus_error armv7l Sorry for the trouble but this is the easiest way to resolve things! If possible I'd like to resolve this within freebayes itself.

I believe FreeBayes chokes on 'N's in the CIGAR string (splice junctions). Cheers, Miika mjafin commented Aug 3, 2014 @ekg I wonder if you have any updates on this by any chance?